Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More

Thermo Scientific™ M13/pUC Reverse Sequencing Primer (-46), 24-mer

Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends.

Supplier:  Thermo Scientific™ SO115

Catalog No. FERSO115

  • $85.65 / Each of 1

    Save 8%

    Reg : $93.00

    The following deviations and disclosures may produce prices below stated discounts but will not trigger price reductions: Price shown reflects a temporary, promotional price reduction. No other purchase or commercial obligation required to receive the reduced price. Price may change at any time. Promotional price valid on web orders only. Your contract pricing may differ. Other exclusions apply.
Add to Cart

Description

Description

Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

Primer Sequence: 5'-d(GAGCGGATAACAATTTCACACAGG)-3'

TRUSTED_SUSTAINABILITY
Specifications

Specifications

Sequencing Primer
Dry Ice
M13
pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II
Liquid
M13/pUC Reverse Sequencing Primer (-46), 24-mer, 10 μM (42 μL)

Store at –20°C.
10 μM
42 μL
Sequencing
Product Suggestions

Product Suggestions

SDS
Documents

Documents

Product Certifications
Promotions

Promotions

Provide Content Correction

We continue to work to improve your shopping experience and your feedback regarding this content is very important to us. Please use the form below to provide feedback related to the content on this product.

Product Title

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Cancel Submit

For Research Use Only. Not for use in diagnostic procedures.