Learn More
Thermo Scientific™ M13/pUC Reverse Sequencing Primer (-46), 24-mer
Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends.
Supplier: Thermo Scientific™ SO115
Description
Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR
Primer Sequence: 5'-d(GAGCGGATAACAATTTCACACAGG)-3'
![TRUSTED_SUSTAINABILITY](/content/dam/fishersci/glyphs/Sustain_Badge.png)
Specifications
Sequencing Primer | |
Dry Ice | |
M13 | |
pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II | |
Liquid |
M13/pUC Reverse Sequencing Primer (-46), 24-mer, 10 μM (42 μL) Store at –20°C. |
|
10 μM | |
42 μL | |
Sequencing |
We continue to work to improve your shopping experience and your feedback regarding this content is very important to us. Please use the form below to provide feedback related to the content on this product.
For Research Use Only. Not for use in diagnostic procedures.